Evaluation of a screw insertion landmark for a minimally invasive repair technique in induced bilateral sacroiliac luxation in feline cadavers.

OBJECTIVES: The aim of this study was to describe an alternative landmark for screw insertion into the body of the ilium with bilateral sacroiliac luxation in cats. METHODS: Seven cat cadavers with artificially induced bilateral sacroiliac luxation were used. The screw insertion point was determined using the caudal iliac crest and cranial acetabular rim. These two points make the first guideline; a second guideline ran perpendicular to the caudal iliac crest point. The screw insertion point was halfway along the second guideline across the ilium body. Surgery was performed in a minimally invasive manner using fluoroscopy. RESULTS: Postoperative radiographs and CT were performed. In the postoperative evaluation, the sacroiliac joint reduction percentage was almost 90% and there was no significant difference in pelvic canal diameter ratio before and after surgery. Screw depth/sacral width was >60% in all cadavers. On CT, the angle between the screw and sacrum wing was within the normal range of 96.24° to the left and 98.65° to the right, except in one case. CONCLUSIONS AND RELEVANCE: In previous studies, surgical repair was based on having an intact contralateral ilium. However, this method is not applicable to patients with bilateral sacroiliac luxation and is mostly performed using open reduction methods. The screw insertion point suggested in this study offers a potential alternative repair technique for patients with bilateral sacroiliac luxation.

Identification of chalcones as potent and selective PDE5A1 inhibitors.

Chalcones have an affinity for many receptors, enzymes, and transcription factors as flavonoid analogues. Their most studied pharmacological action is that of vasodilatation due to inhibition of phosphodiesterase 5A1 (PDE5A1). To this end, we have established a recursive partitioning model with 3 chemical descriptors for the prediction of compounds that can inhibit PDE5A1. This model was able to predict active compounds with an accuracy of 82.8%. Compound 4 was found to be a potent and selective inhibitor, with a relatively low IC(50) value. The binding mechanism of this compound was also investigated through molecular docking studies.

Identification of novel inhibitors of HCV RNA-dependent RNA polymerase by pharmacophore-based virtual screening and in vitro evaluation.

Hepatitis C virus (HCV) is the major etiological agent of non-A, non-B hepatitis where no effective treatment is available. The HCV NS5B with RNA-dependent RNA polymerase (RdRp) activity is a key target for the treatment of HCV infection. Here we report novel NS5B polymerase inhibitors identified by virtual screening and in vitro evaluation of their inhibitory activities. On the basis of a newly identified binding pocket of NS5B, distinct from the nucleotide binding site but highly conserved among various HCV isolates, we performed virtual screening of compounds that fit this binding pocket from the available chemical database of 3.5 million compounds. The inhibitory activities of the in silico selected 119 compounds were estimated with in vitro RdRp assay. Three compounds with IC50 values of about 20 microM were identified, and their kinetic analyses suggest that these compounds are noncompetitive inhibitors with respect to the ribonucleotide substrate. Furthermore, the single-point mutations of the conserved residues in the binding pocket of NS5B resulted in the significant decrease of the RdRp activity, indicating that the binding pocket presented here might be important for the therapeutic intervention of HCV. These novel inhibitors would be useful for the development of effective anti-HCV agents.

Quinazolines as potent and highly selective PDE5 inhibitors as potential therapeutics for male erectile dysfunction.

In an effort to minimize side effects associated with low selectivity against PDE isozymes, we have successfully identified a series of 6,7,8-substituted quinzaolines as potent inhibitors of PDE5 with high level of isozyme selectivity, especially against PDE6 and PDE11. PDE5 potency and isozyme selectivity of quinazolines were greatly improved with substitutions both at 6- and 8-position. The synthesis, structure-activity relationships and in vivo efficacy of this novel series of potent PDE5 inhibitors are described.

IDMap: facilitating the detection of potential leads with therapeutic targets.

UNLABELLED: Pharmaceutical industry has been striving to reduce the costs of drug development and increase productivity. Among the many different attempts, drug repositioning (retargeting existing drugs) comes into the spotlight because of its financial efficiency. We introduce IDMap which predicts novel relationships between targets and chemicals and thus is capable of repositioning the marketed drugs by using text mining and chemical structure information. Also capable of mapping commercial chemicals to possible drug targets and vice versa, IDMap creates convenient environments for identifying the potential lead and its targets, especially in the field of drug repositioning. AVAILABILITY: IDMap executable and its user manual including color images are freely available to non-commercial users at http://www.equispharm.com/idmap

Design and biological evaluation of novel tubulin inhibitors as antimitotic agents using a pharmacophore binding model with tubulin.

Although the structure has been elucidated for the binding of colchicine and podophyllotoxin as potent destabilizer for microtubule formation, very little is known about MDL-27048, a competitive inhibitor for colchicine and podophyllotoxin. The structural basis for the interaction of antimitotic agents with tubulin was investigated by molecular modeling, and we propose binding models for MDL-27048 against tubulin. The proposed model was not only consistent with previous competition experiment data between colchicine and MDL-27048, but further suggested an additional binding cavity on tubulin. Based on this finding from the proposed MDL-tubulin complex, we performed molecular design studies to identify new antimitotic agents. These new chalcone derivatives exerted growth inhibitory effects on all four human hepatoma and one renal epithelial cell lines tested and induced strong cell cycle arrest at G2/M phase. Furthermore, these compounds exhibited a strong inhibitory effect on tubulin polymerization in vitro. Therefore, we suggest that the validated MDL-27048 model would serve as a potent platform for designing new molecular entities for anticancer agents targeted to microtubules.

Novel inhibitors targeted to methionine aminopeptidase 2 (MetAP2) strongly inhibit the growth of cancers in xenografted nude model.

Inhibition of angiogenesis is emerging as a promising strategy for the treatment of cancer. In our study reported here, the effects of 4 highly potent methionine aminopeptidase 2 (MetAP2) inhibitors, IDR-803, IDR-804, IDR-805 and CKD-732 (designed by structure-based molecular modeling), on angiogenesis and tumor growth were assessed. Concentrations of these inhibitors as low as 2.5 nM were able to inhibit the growth of human umbilical vein endothelial cells (HUVEC) by as much as 50%, arresting growth in the G1 stage of mitosis. An intracellular accumulation of p21(WAF1/Cip1) protein was also observed. Furthermore, at higher concentrations (25 nM) of these 4 MetAP2 inhibitors, a significant induction of apoptosis was apparent in the same HUVEC cultures. As a result of these findings, the possible anticancer effects of these inhibitors were examined, utilizing the SNU-398 hepatoma cell line. Interestingly, pretreatment with these inhibitors led to an increased number of apoptotic cells of up to 60% or more, compared to untreated controls. Moreover, utilizing an in vivo xenografted murine model, these inhibitors suppressed the growth of engrafted tumor. In conclusion, these 4 inhibitory compounds potently exert an antiangiogenic effect to inhibit the growth of cancers in vivo and could potentially be useful for the treatment of a variety of cancers.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII RFLPs, we found three gene deletions. When the 20 mutations were depicted in a 3-dimensional model of IDS protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas. We hope that these findings will further the understanding of the underlying mechanisms associated with the disease.